FUGW-RUSH-LAMP1-mScarleti
(Plasmid
#228526)
-
PurposeLentiviral vector, expresses Strep-KDEL-IRES-SBP-(Rat)LAMP1-mScarleti in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228526 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUWG-RUSH-Strep-KDEL
- Backbone size w/o insert (bp) 10726
- Total vector size (bp) 12824
-
Modifications to backboneChimeric Intron - IRES2 was introduced
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLAMP1
-
SpeciesR. norvegicus (rat)
-
Entrez GeneLamp1 (a.k.a. LGP120)
- Promoter Ubc
-
Tags
/ Fusion Proteins
- Streptavidin-KDEL (N terminal on backbone)
- Streptavidin Binding Protein (SBP) (N terminal on insert)
- mScarleti (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgctttacatgtgtttagtcgaggt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.05.16.594502 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUGW-RUSH-LAMP1-mScarleti was a gift from Ginny Farias (Addgene plasmid # 228526 ; http://n2t.net/addgene:228526 ; RRID:Addgene_228526) -
For your References section:
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neurons. Li CH, Kersten N, Ozkan N, Nguyen DTM, Koppers M, Post H, Altelaar M, Farias GG. Nat Commun. 2024 Dec 30;15(1):10829. doi: 10.1038/s41467-024-55052-w. 10.1038/s41467-024-55052-w PubMed 40016183