pCMV-THRA-RFP-EGFP
(Plasmid
#228537)
-
PurposeBichromatic fluorescent reporter of THRA isoform 1 and isoform 2 splicing in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N3
-
Backbone manufacturerNovoPro
- Backbone size w/o insert (bp) 4445
- Total vector size (bp) 12547
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsKanamycin (final 50 ug/ml)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameThyroid Hormone Receptor Alpha
-
Alt nameTHRA
-
Alt nameTRalpha
-
Alt nameTHRalpha
-
SpeciesH. sapiens (human)
-
Insert Size (bp)12547
-
GenBank IDENSG00000126351
-
Entrez GeneTHRA (a.k.a. AR7, CHNG6, EAR7, ERB-T-1, ERBA, ERBA1, NR1A1, THRA1, THRA2, THRalpha, THRalpha1, THRalpha2, TRalpha, TRalpha1, TRalpha2, c-ERBA-1, c-erbA)
- Promoter CMV
-
Tags
/ Fusion Proteins
- tagRFP (C terminal on insert)
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer tgacgtcaatgggagtttgt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-THRA-RFP-EGFP was a gift from Markus Schuelke (Addgene plasmid # 228537 ; http://n2t.net/addgene:228537 ; RRID:Addgene_228537) -
For your References section:
Bichromatic Splicing Detector Allows Quantification of THRA1 and THRA2 Splicing Isoforms in Single Cells by Fluorescent Live-Cell Imaging. Graceffo E, Pedersen E, Rosario M, Krude H, Schuelke M. Int J Mol Sci. 2024 Dec 17;25(24):13512. doi: 10.3390/ijms252413512. 10.3390/ijms252413512 PubMed 39769274