Skip to main content

CHGA-eGFP
(Plasmid #228569)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228569 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)-C-eGFP
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chromogranin-A
  • Alt name
    CgA
  • Alt name
    Pituitary secretory protein I (SP-I)
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001275.3
  • Entrez Gene
    CHGA (a.k.a. CGA, PHE5, PHES)
  • Promoter cmv
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CHGA-eGFP was a gift from Geert van den Bogaart (Addgene plasmid # 228569 ; http://n2t.net/addgene:228569 ; RRID:Addgene_228569)
  • For your References section:

    Inflammation Promotes Proteolytic Processing of the Prohormone Chromogranin A by Macrophages. Ioannidis M, van Dijk H, Muntjewerff EM, Chirasani VR, Warner H, van den Dool W, Grijpstra P, Bianchi F, Mahata SK, van den Bogaart G. J Endocr Soc. 2025 May 15;9(7):bvaf090. doi: 10.1210/jendso/bvaf090. eCollection 2025 Jul. 10.1210/jendso/bvaf090 PubMed 40458085