pX459-SOS1(dog)-gRNA1
(Plasmid
#228755)
-
PurposeA knockout vector for dog SOS1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228755 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX459
-
Backbone manufacturerhttps://www.addgene.org/48139/
- Backbone size w/o insert (bp) 9158
- Total vector size (bp) 9178
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameA gRNA targeting the dog SOS1 gene and the cDNA of CRISPR-Cas9
-
gRNA/shRNA sequencegcttatatgccactcgactg
-
Speciescanis lupus
-
Entrez GeneSOS1
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-SOS1(dog)-gRNA1 was a gift from Michiyuki Matsuda (Addgene plasmid # 228755 ; http://n2t.net/addgene:228755 ; RRID:Addgene_228755) -
For your References section:
Front-biased activation of Ras-Rab5-Rac1 loop coordinates collective cell migration. Jikko Y, Deguchi E, Matsuda K, Hino N, Tsukiji S, Matsuda M, Terai K. J Cell Sci. 2025 Jul 16:jcs.263779. doi: 10.1242/jcs.263779. 10.1242/jcs.263779 PubMed 40667649