Skip to main content

pSUPER-Rac1(dog)
(Plasmid #228760)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228760 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSUPER
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    A shRNA targeting the dog Rac1 gene
  • gRNA/shRNA sequence
    GCCTTCGCACTCAATGCCAAG
  • Species
    canis lupus
  • Entrez Gene
    RAC1 (a.k.a. RAC2)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: This plasmid contains a single A nucleotide deletion in the second copy of the Rac1 shRNA. This deletion does not impact plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSUPER-Rac1(dog) was a gift from Michiyuki Matsuda (Addgene plasmid # 228760 ; http://n2t.net/addgene:228760 ; RRID:Addgene_228760)
  • For your References section:

    Front-biased activation of Ras-Rab5-Rac1 loop coordinates collective cell migration. Jikko Y, Deguchi E, Matsuda K, Hino N, Tsukiji S, Matsuda M, Terai K. J Cell Sci. 2025 Jul 16:jcs.263779. doi: 10.1242/jcs.263779. 10.1242/jcs.263779 PubMed 40667649