pSUPER-Rac1(dog)
(Plasmid
#228760)
-
PurposeA knockdown vector for dog Rac1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSUPER
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameA shRNA targeting the dog Rac1 gene
-
gRNA/shRNA sequenceGCCTTCGCACTCAATGCCAAG
-
Speciescanis lupus
-
Entrez GeneRAC1 (a.k.a. RAC2)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid contains a single A nucleotide deletion in the second copy of the Rac1 shRNA. This deletion does not impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUPER-Rac1(dog) was a gift from Michiyuki Matsuda (Addgene plasmid # 228760 ; http://n2t.net/addgene:228760 ; RRID:Addgene_228760) -
For your References section:
Front-biased activation of Ras-Rab5-Rac1 loop coordinates collective cell migration. Jikko Y, Deguchi E, Matsuda K, Hino N, Tsukiji S, Matsuda M, Terai K. J Cell Sci. 2025 Jul 16:jcs.263779. doi: 10.1242/jcs.263779. 10.1242/jcs.263779 PubMed 40667649