pCJ1022
(Plasmid
#228762)
-
PurposePlasmid expressing Cas9 and 2 gRNAs for mouse Pkd2. Use for disruption of mouse Pkd2 in cultured cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (PX458)
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 9300
- Total vector size (bp) 9644
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePkd2 gRNAs
-
gRNA/shRNA sequencegRNA1: actcggagttggcgtagacg; gRNA2: acgcacgcagttccattccg
-
SpeciesM. musculus (mouse)
-
Entrez GenePkd2 (a.k.a. C030034P18Rik, PC2, TRPP2)
- Promoter hU6
-
Tags
/ Fusion Proteins
- 3XFLAG (N terminal on backbone)
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer agcgcgtgcgccaattctgcagacaaatggc
- 3′ sequencing primer gccatttgtctgcagaattggcgcacgcgct
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCJ1022 was a gift from Bradley Yoder (Addgene plasmid # 228762 ; http://n2t.net/addgene:228762 ; RRID:Addgene_228762)