MSI1_2xRRM_pGEX_Flag_noSBP
(Plasmid
#228796)
-
PurposeRecombinant expression of mouse MSI1 with dual-affinity tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-6P-1
- Backbone size w/o insert (bp) 5012
- Total vector size (bp) 6101
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMusashi-1
-
Alt nameMSI1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1089
-
GenBank IDNM_008629.1
-
Entrez GeneMsi1 (a.k.a. Msi1h, Musahi1, m-Msi-1)
-
Tags
/ Fusion Proteins
- GST (N terminal on insert)
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.17.618930 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSI1_2xRRM_pGEX_Flag_noSBP was a gift from Daniel Dominguez (Addgene plasmid # 228796 ; http://n2t.net/addgene:228796 ; RRID:Addgene_228796) -
For your References section:
Dissecting RNA selectivity mediated by tandem RNA-binding domains. Harris SE, Hu Y, Bridges K, Cavazos FF Jr, Martyr JG, Guzman BB, Murn J, Aleman MM, Dominguez D. J Biol Chem. 2025 May;301(5):108435. doi: 10.1016/j.jbc.2025.108435. Epub 2025 Mar 20. 10.1016/j.jbc.2025.108435 PubMed 40120682