EHMT1_exon 3_gRNA
(Plasmid
#228809)
-
PurposeCRISPR targeting of human EHMT1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP
-
Backbone manufacturerFeng Zhang (Addgene # 48138)
- Backbone size w/o insert (bp) 9300
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting EHMT1 exon 3
-
gRNA/shRNA sequenceGCGCCGACGTCAAGGTCCACA
-
SpeciesH. sapiens (human)
-
Entrez GeneEHMT1 (a.k.a. EHMT1-IT1, EUHMTASE1, Eu-HMTase1, FP13812, GLP, GLP1, KLEFS1, KMT1D)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.11.01.564969 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EHMT1_exon 3_gRNA was a gift from Shravanti Rampalli (Addgene plasmid # 228809 ; http://n2t.net/addgene:228809 ; RRID:Addgene_228809) -
For your References section:
A cytoplasmic form of EHMT1N methylates viral proteins to enable inclusion body maturation and efficient viral replication. Biligiri KK, Sharma NR, Mohanty A, Sarkar DP, Vemula PK, Rampalli S.. PLOS Biology 22(11): e3002871. 10.1371/journal.pbio.3002871