pCSCG-Fc-pST3Gal1 H302A
(Plasmid #228820)

• Purpose: Expresses Fc-fusion pST3Gal1 H302A in mammalian cells
• Depositing Lab: Sriram Neelamegham
• Publication: Hombu et al Nat Commun. 2025 Jul 18;16(1):6637. doi: 10.1038/s41467-025-62018-z.

Backbone

• Vector backbone: pCSCG
• Backbone size w/o insert (bp): 7772
• Total vector size (bp): 9503
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Fc-pST3Gal1 H302A
• Species: H. sapiens (human); pig
• Insert Size (bp): 1731
• Mutation: amino acids 1-59 of pST3Gal1 were deleted and H302A is introduced in pST3Gal1
• Promoter: CMV
• Tags / Fusion Proteins:
  • human IgG1 Fc region (N terminal on insert)
  • 6His tag (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAGCATTGGTAGCTGCTGTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Sriram Neelamegham (Addgene #228819)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert size includes N-terminal Fc portion.
Fc-pST3Gal1 H302A shows binding to Siaα2,3Galβ1,3[GlcNAc(β1,6)]GalNAcα-Ser/Thr, but does not have enzymatic activity.

Please visit https://doi.org/10.21203/rs.3.rs-5004188/v1 for the preprint.

Plasmid contains a truncation that affects lentiviral components in the plasmid. Plasmid can still be cloned using E. coli and shows normal expression after transient transfection, but cannot be used to produce lentiviral vectors.