Skip to main content

pCSCG-Fc-pST3Gal1 Dead
(Plasmid #228821)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228821 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCSCG
  • Backbone size w/o insert (bp) 7772
  • Total vector size (bp) 9503
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fc-pST3Gal1 Dead
  • Species
    H. sapiens (human); pig
  • Insert Size (bp)
    1731
  • Mutation
    amino acids 1-59 of pST3Gal1 were deleted and Q108A/Y233A/Y269F are introduced in pST3Gal1
  • Promoter CMV
  • Tags / Fusion Proteins
    • human IgG1 Fc region (N terminal on insert)
    • 6His tag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGCATTGGTAGCTGCTGTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Sriram Neelamegham (Addgene #228819)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert size includes N-terminal Fc portion.
Fc-pST3Gal1 Dead neither shows binding to glycosylated epitopes nor have enzymatic activity.

Please visit https://doi.org/10.21203/rs.3.rs-5004188/v1 for the preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSCG-Fc-pST3Gal1 Dead was a gift from Sriram Neelamegham (Addgene plasmid # 228821 ; http://n2t.net/addgene:228821 ; RRID:Addgene_228821)
  • For your References section:

    Engineering glycosyltransferases into glycan binding proteins using a mammalian surface display platform. Hombu R, Beatty LE, Tomaszewski J, Park S, Neelamegham S. Nat Commun. 2025 Jul 18;16(1):6637. doi: 10.1038/s41467-025-62018-z. 10.1038/s41467-025-62018-z PubMed 40681527