pLV_3xFLAG-ATP6V0A3-mScarlet
(Plasmid
#228867)
-
PurposeStable expression of V-ATPase subunit ATP6V0A3 with N-terminal 3xFLAG and C-terminal mScarlet
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV-Ef1a-IRES Hygro
-
Backbone manufacturerAddgene #85134
- Backbone size w/o insert (bp) 9614
- Total vector size (bp) 12436
-
Vector typeLentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP6V0A3
-
Alt nameTCIRG1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3267
-
Entrez GeneTCIRG1 (a.k.a. ATP6N1C, ATP6V0A3, Atp6i, OC-116kDa, OC116, OPTB1, Stv1, TIRC7, Vph1, a3)
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- mScarlet (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGAGTGGGTGGAGACTGAAG
- 3′ sequencing primer CTTCGGCCAGTAACGTTAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_3xFLAG-ATP6V0A3-mScarlet was a gift from Wilhelm Palm (Addgene plasmid # 228867 ; http://n2t.net/addgene:228867 ; RRID:Addgene_228867) -
For your References section:
Direct control of lysosomal catabolic activity by mTORC1 through regulation of V-ATPase assembly. Ratto E, Chowdhury SR, Siefert NS, Schneider M, Wittmann M, Helm D, Palm W. Nat Commun. 2022 Aug 17;13(1):4848. doi: 10.1038/s41467-022-32515-6. 10.1038/s41467-022-32515-6 PubMed 35977928