Skip to main content

pCEFL-HAx2-TEADiv2
(Plasmid #228873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228873 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCEFL
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TEADiv2
  • Alt name
    TEAD dominant-negative inhibitor 2xHA tagged
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    321
  • Tag / Fusion Protein
    • 2xHA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HA-tagged inhibitor of the interaction of YAP1 and TAZ with TEAD transcription factors with nuclear localization signal. Optimized by a D93E mutation in the YAP1 TBD with respect to original TEADi (Addgene #140144). As with other dominant negative proteins, good levels of expression are necessary for TEADi to block TEADs.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCEFL-HAx2-TEADiv2 was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 228873 ; http://n2t.net/addgene:228873 ; RRID:Addgene_228873)
  • For your References section:

    An improved TEAD dominant-negative protein inhibitor to study Hippo YAP1/TAZ-dependent transcription. Branch B, Yuan Y, Cascone M, Raimondi F, Iglesias-Bartolome R. bioRxiv [Preprint]. 2024 Oct 3:2024.10.03.615022. doi: 10.1101/2024.10.03.615022. 10.1101/2024.10.03.615022 PubMed 39502361