Skip to main content

MPC1-AA-FLAG
(Plasmid #228904)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228904 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5389
  • Total vector size (bp) 5749
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MPC1
  • Alt name
    mitochondrial pyruvate carrier 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    336
  • Mutation
    K45 and K46 motif sites were both replaced with alanines
  • Entrez Gene
    Mpc1 (a.k.a. 0610006G08Rik, 3830411I18Rik, Brp44l)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTCGGATCCCCGCCACCATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://pubmed.ncbi.nlm.nih.gov/38562794/ for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MPC1-AA-FLAG was a gift from Ghazaleh Ashrafi (Addgene plasmid # 228904 ; http://n2t.net/addgene:228904 ; RRID:Addgene_228904)
  • For your References section:

    Mitochondrial pyruvate transport regulates presynaptic metabolism and neurotransmission. Tiwari A, Myeong J, Hashemiaghdam A, Stunault MI, Zhang H, Niu X, Laramie MA, Sponagel J, Shriver LP, Patti GJ, Klyachko VA, Ashrafi G. Sci Adv. 2024 Nov 15;10(46):eadp7423. doi: 10.1126/sciadv.adp7423. Epub 2024 Nov 15. 10.1126/sciadv.adp7423 PubMed 39546604