MPC1-QQ-FLAG
(Plasmid
#228905)
-
PurposeExpression of mouse MPC1 in which K45 and K46 motif sites were replaced with glutamine to mimic acetylated lysines with a C terminal FLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.0
- Backbone size w/o insert (bp) 5430
- Total vector size (bp) 5790
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMPC1
-
Alt namemitochondrial pyruvate carrier 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)336
-
MutationK45 and K46 motif sites were both replaced with glutamines
-
Entrez GeneMpc1 (a.k.a. 0610006G08Rik, 3830411I18Rik, Brp44l)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCTCGGATCCGCCACCATGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/38562794/ for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MPC1-QQ-FLAG was a gift from Ghazaleh Ashrafi (Addgene plasmid # 228905 ; http://n2t.net/addgene:228905 ; RRID:Addgene_228905) -
For your References section:
Mitochondrial pyruvate transport regulates presynaptic metabolism and neurotransmission. Tiwari A, Myeong J, Hashemiaghdam A, Stunault MI, Zhang H, Niu X, Laramie MA, Sponagel J, Shriver LP, Patti GJ, Klyachko VA, Ashrafi G. Sci Adv. 2024 Nov 15;10(46):eadp7423. doi: 10.1126/sciadv.adp7423. Epub 2024 Nov 15. 10.1126/sciadv.adp7423 PubMed 39546604