sg_Snrpa_i2-ipUSEPR-TR657
(Plasmid
#228923)
-
PurposeKnockdown of Snrpa in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonesgTR657_ipUSEPR
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesg_Snrpa_i2
-
gRNA/shRNA sequenceGTAATCACGGCGGGCAAACT
-
SpeciesM. musculus (mouse)
-
Entrez GeneSnrpa (a.k.a. C430021M15Rik, Rnu1a-1, Rnu1a1, U1-A, U1A)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sg_Snrpa_i2-ipUSEPR-TR657 was a gift from Sika Zheng (Addgene plasmid # 228923 ; http://n2t.net/addgene:228923 ; RRID:Addgene_228923) -
For your References section:
Epistatic interactions between NMD and TRP53 control progenitor cell maintenance and brain size. Lin L, Zhao J, Kubota N, Li Z, Lam YL, Nguyen LP, Yang L, Pokharel SP, Blue SM, Yee BA, Chen R, Yeo GW, Chen CW, Chen L, Zheng S. Neuron. 2024 Jul 3;112(13):2157-2176.e12. doi: 10.1016/j.neuron.2024.04.006. Epub 2024 May 1. 10.1016/j.neuron.2024.04.006 PubMed 38697111