pSUMO1-del
(Plasmid
#228950)
-
Purposeexpress the full-length human SAE1:SAE2 heterodimer ( where SAE1 is untagged and SAE2 contains an N-terminal tag : MGSSHHHHHHSQDADLNSRVD, derivated from the Addgene plasmid #52258 pSUMO1)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228950 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDFDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3781
- Total vector size (bp) 6404
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameUBA 2
-
Alt nameSAE-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1986
-
GenBank IDNM_005499.2
-
Entrez GeneUBA2 (a.k.a. ACCES, ARX, HRIHFB2115, SAE2)
- Promoter RBS
-
Tag
/ Fusion Protein
- His tag and thrombine cleavage site : MGSSHHHHHHSQDADLNSRVD (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer GATGAGAAAGAGAATCTCAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAos1
-
Alt nameSAE-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1044
-
GenBank IDNM_005500.2
-
Entrez GeneSAE1 (a.k.a. AOS1, HSPC140, SUA1, UBLE1A)
- Promoter T7-lac
-
Tag
/ Fusion Protein
- N/A
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer T7-terminator
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSUMO1-del is derivated from Addgene plasmid #52258 ( 7815 pb) from Primo Schär. The SUMO1 and UBC9 sequences were deleted by PCR mutagenesis.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUMO1-del was a gift from Marcin Suskiewicz (Addgene plasmid # 228950 ; http://n2t.net/addgene:228950 ; RRID:Addgene_228950)