pSUMO1-del
(Plasmid #228950)

• Purpose: express the full-length human SAE1:SAE2 heterodimer ( where SAE1 is untagged and SAE2 contains an N-terminal tag : MGSSHHHHHHSQDADLNSRVD, derivated from the Addgene plasmid #52258 pSUMO1)
• Depositing Lab: Marcin Suskiewicz
• Publication: Production and purification of SUMO-UBC9 and SUMO-RANGAP1CTD (unpublished)

Backbone

• Vector backbone: pCDFDuet-1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 3781
• Total vector size (bp): 6404
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: UBA 2
• Alt name: SAE-2
• Species: H. sapiens (human)
• Insert Size (bp): 1986
• GenBank ID: NM_005499.2
• Entrez Gene: UBA2 (a.k.a. ACCES, ARX, HRIHFB2115, SAE2)
• Promoter: RBS
• Tag / Fusion Protein:
  • His tag and thrombine cleavage site : MGSSHHHHHHSQDADLNSRVD (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: NheI (destroyed during cloning)
• 5′ sequencing primer: GATGAGAAAGAGAATCTCAG

Gene/Insert 2

• Gene/Insert name: Aos1
• Alt name: SAE-1
• Species: H. sapiens (human)
• Insert Size (bp): 1044
• GenBank ID: NM_005500.2
• Entrez Gene: SAE1 (a.k.a. AOS1, HSPC140, SUA1, UBLE1A)
• Promoter: T7-lac
• Tag / Fusion Protein:
  • N/A

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: T7-terminator

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pSUMO1-del is derivated from Addgene plasmid #52258 ( 7815 pb) from Primo Schär. The SUMO1 and UBC9 sequences were deleted by PCR mutagenesis.