Skip to main content

pLKO.1-mTagBFP2-rMPC1 shRNA
(Plasmid #229016)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229016 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 7087
  • Total vector size (bp) 7135
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MPC1
  • Alt name
    mitochondrial pyruvate carrier 1
  • gRNA/shRNA sequence
    CAAACGAAGTCGCTCAGCTCACTCGAGTGAGCTGAGCGACTTCGTTTG
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Mpc1 (a.k.a. Brp44l, SLC54A1)
  • Promoter U6
  • Tag / Fusion Protein
    • mTagBFP2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://pubmed.ncbi.nlm.nih.gov/38562794/ for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-mTagBFP2-rMPC1 shRNA was a gift from Ghazaleh Ashrafi (Addgene plasmid # 229016 ; http://n2t.net/addgene:229016 ; RRID:Addgene_229016)
  • For your References section:

    Mitochondrial pyruvate transport regulates presynaptic metabolism and neurotransmission. Tiwari A, Myeong J, Hashemiaghdam A, Stunault MI, Zhang H, Niu X, Laramie MA, Sponagel J, Shriver LP, Patti GJ, Klyachko VA, Ashrafi G. Sci Adv. 2024 Nov 15;10(46):eadp7423. doi: 10.1126/sciadv.adp7423. Epub 2024 Nov 15. 10.1126/sciadv.adp7423 PubMed 39546604