Skip to main content

pRDA052H_sgFOCAD #2
(Plasmid #229024)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229024 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRDA_052
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FOCAD gRNA
  • gRNA/shRNA sequence
    AATCACCCCAACTAACCTCCAGG
  • Species
    H. sapiens (human)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRDA052H_sgFOCAD #2 was a gift from Francisca Vazquez (Addgene plasmid # 229024 ; http://n2t.net/addgene:229024 ; RRID:Addgene_229024)
  • For your References section:

    SKI complex loss renders 9p21.3-deleted or MSI-H cancers dependent on PELO. Borck PC, Boyle I, Jankovic K, Bick N, Foster K, Lau AC, Parker-Burns LI, Lubicki DA, Li T, Borah AA, Lofaso NJ, Das Sharma S, Chan T, Kishen RV, Adeagbo A, Raghavan S, Aquilanti E, Prensner JR, Krill-Burger JM, Golub TR, Campbell CD, Dempster JM, Chan EM, Vazquez F. Nature. 2025 Feb 5. doi: 10.1038/s41586-024-08509-3. 10.1038/s41586-024-08509-3 PubMed 39910293