pRDA052H_sgFOCAD #2
(Plasmid
#229024)
-
PurposeExpression of a EnAsCas12a guide targeting FOCAD
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRDA_052
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFOCAD gRNA
-
gRNA/shRNA sequenceAATCACCCCAACTAACCTCCAGG
-
SpeciesH. sapiens (human)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRDA052H_sgFOCAD #2 was a gift from Francisca Vazquez (Addgene plasmid # 229024 ; http://n2t.net/addgene:229024 ; RRID:Addgene_229024) -
For your References section:
SKI complex loss renders 9p21.3-deleted or MSI-H cancers dependent on PELO. Borck PC, Boyle I, Jankovic K, Bick N, Foster K, Lau AC, Parker-Burns LI, Lubicki DA, Li T, Borah AA, Lofaso NJ, Das Sharma S, Chan T, Kishen RV, Adeagbo A, Raghavan S, Aquilanti E, Prensner JR, Krill-Burger JM, Golub TR, Campbell CD, Dempster JM, Chan EM, Vazquez F. Nature. 2025 Feb 5. doi: 10.1038/s41586-024-08509-3. 10.1038/s41586-024-08509-3 PubMed 39910293