pTE5427
(Plasmid
#229034)
-
PurposetetO-phi29 DNA polymerase ‘dead’ reporter: PT7-tetO-B0035-p2 D249E-T7 terminator, AmpR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepME_Cp_0_7-8_001
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePT7-tetO-RBS35-phi29 DNAP (D249E, dead)-T7term
- Promoter PT7-tetO
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CGGTTCCTGGCCTTTTGC
- 3′ sequencing primer GATAGGTGCCTCACTGATTAAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.07.08.663768 bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE5427 was a gift from Tobias Erb (Addgene plasmid # 229034 ; http://n2t.net/addgene:229034 ; RRID:Addgene_229034) -
For your References section:
Genetically encoded control of in vitro transcription-translation coupled DNA replication. Barthel S, Hoffmann-Becking M, Karimov IG, Erb TJ. bioRxiv 2025.07.08.663768; doi: 10.1101/2025.07.08.663768 10.1101/2025.07.08.663768