SOPP3-HA-nes
(Plasmid
#229071)
-
PurposeExpresses SOPP3 in the cytosol of mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 229071 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePCS2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameExpress SOPP3 in the cytosol of mammalian cells
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Other
- 5′ sequencing primer atggagaaaagtttcgtgat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SOPP3-HA-nes was a gift from Weijun Pan (Addgene plasmid # 229071 ; http://n2t.net/addgene:229071 ; RRID:Addgene_229071) -
For your References section:
Photoactivated SOPP3 enables APEX2-mediated proximity labeling with high spatio-temporal resolution in live cells. Qu D, Li Y, Liu Q, Cao B, Cao M, Lin X, Shen C, Zou P, Zhou H, Zhang W, Pan W. Cell Res. 2025 Feb;35(2):149-152. doi: 10.1038/s41422-024-01061-9. Epub 2024 Dec 10. 10.1038/s41422-024-01061-9 PubMed 39653757