pEP17
(Plasmid
#229234)
-
PurposePutP (Sodium/proline symporter) under tet operator, TetR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDSG360
- Backbone size w/o insert (bp) 3617
- Total vector size (bp) 5126
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameputP (Sodium/proline symporter)
-
SpeciesE. coli
-
Insert Size (bp)1509
-
Entrez GeneputP (a.k.a. b1015, ECK1006, putC)
- Promoter tet operator
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agatactgagcactactagagaaagaggagaaatactagatggctattagcacacc
- 3′ sequencing primer gactgcagcggccgctactagttaagtcccttagctttcctg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The original Km cassette from pDSG360 was changed to Cm
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEP17 was a gift from Yolanda Schaerli (Addgene plasmid # 229234 ; http://n2t.net/addgene:229234 ; RRID:Addgene_229234) -
For your References section:
Uptake and leakage rates differentially shape community arrangement and composition of microbial consortia. Pignon E, Hollo G, Steiner T, van Vliet S, Schaerli Y. ISME J. 2025 Jun 13:wraf122. doi: 10.1093/ismejo/wraf122. 10.1093/ismejo/wraf122 PubMed 40509754