Skip to main content

pEP17
(Plasmid #229234)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229234 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDSG360
  • Backbone size w/o insert (bp) 3617
  • Total vector size (bp) 5126
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    putP (Sodium/proline symporter)
  • Species
    E. coli
  • Insert Size (bp)
    1509
  • Entrez Gene
    putP (a.k.a. b1015, ECK1006, putC)
  • Promoter tet operator

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agatactgagcactactagagaaagaggagaaatactagatggctattagcacacc
  • 3′ sequencing primer gactgcagcggccgctactagttaagtcccttagctttcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The original Km cassette from pDSG360 was changed to Cm

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEP17 was a gift from Yolanda Schaerli (Addgene plasmid # 229234 ; http://n2t.net/addgene:229234 ; RRID:Addgene_229234)
  • For your References section:

    Uptake and leakage rates differentially shape community arrangement and composition of microbial consortia. Pignon E, Hollo G, Steiner T, van Vliet S, Schaerli Y. ISME J. 2025 Jun 13:wraf122. doi: 10.1093/ismejo/wraf122. 10.1093/ismejo/wraf122 PubMed 40509754