sgYAP-R-3
(Plasmid
#229447)
-
Purposeknockout of YAP1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiVi
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin ; GFP-P2A-BlastR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgYAP-R-3
-
gRNA/shRNA sequenceGAGCCTCATGGGCACGGTCT;TTGCGGTCAGGTCACGCCGC
-
SpeciesH. sapiens (human)
-
Entrez GeneYAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
- Promoter hU6;bU6;EFS
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgYAP-R-3 was a gift from Christopher Vakoc (Addgene plasmid # 229447 ; http://n2t.net/addgene:229447 ; RRID:Addgene_229447) -
For your References section:
MARK2/MARK3 kinases are catalytic co-dependencies of YAP/TAZ in human cancer. Klingbeil O, Skopelitis D, Tonelli C, Yoshimoto T, Alpsoy A, Panepinto MC, Minicozzi F, Merrill JR, Cafiero AM, Aggarwal D, Russo S, Ha T, Demerdash OE, Wee TL, Spector DL, Lyons SK, Tuveson DA, Cifani P, Vakoc CR. Cancer Discov. 2024 Jul 26. doi: 10.1158/2159-8290.CD-23-1529. 10.1158/2159-8290.CD-23-1529 PubMed 39058094