pGL3_5UTR_Myc_FLuc
(Plasmid
#229502)
-
PurposeMyc 5' untranslated region firefly luciferase reporter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229502 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3_SV40
- Total vector size (bp) 5391
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyc 5'UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)408
- Promoter SV40
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TATTTATGCAGAGGCCGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3_5UTR_Myc_FLuc was a gift from Davide Ruggero (Addgene plasmid # 229502 ; http://n2t.net/addgene:229502 ; RRID:Addgene_229502) -
For your References section:
Functional screen identifies RBM42 as a mediator of oncogenic mRNA translation specificity. Kovalski JR, Sarioglu G, Subramanyam V, Hernandez G, Rademaker G, Oses-Prieto JA, Slota M, Mohan N, Yiakis K, Liu I, Wen KW, Kim GE, Miglani S, Burlingame AL, Goodarzi H, Perera RM, Ruggero D. Nat Cell Biol. 2025 Feb 4. doi: 10.1038/s41556-024-01604-7. 10.1038/s41556-024-01604-7 PubMed 39905246