lenti_U6_miR-Oct4e_TRE12_OCT4(co)-mNeonGreen_WPRE
(Plasmid
#229544)
-
PurposeLentiviral construct to express synthetic miRNA and OCT4-mNeonGreen fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonecustom backbone
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOct4(co)-mNeonGreen
-
SpeciesH. sapiens (human)
-
Mutationcodon-optimized OCT4
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
- Promoter TRE12
-
Tag
/ Fusion Protein
- Oct4-mNeonGreen
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer TGTACAAAAAAGCAGGCTTTAAAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti_U6_miR-Oct4e_TRE12_OCT4(co)-mNeonGreen_WPRE was a gift from Domitilla Del Vecchio (Addgene plasmid # 229544 ; http://n2t.net/addgene:229544 ; RRID:Addgene_229544) -
For your References section:
Synthetic genetic circuits to uncover the OCT4 trajectories of successful reprogramming of human fibroblasts. Ilia K, Shakiba N, Bingham T, Jones RD, Kaminski MM, Aravera E, Bruno S, Palacios S, Weiss R, Collins JJ, Del Vecchio D, Schlaeger TM. Sci Adv. 2023 Dec;9(48):eadg8495. doi: 10.1126/sciadv.adg8495. Epub 2023 Nov 29. 10.1126/sciadv.adg8495 PubMed 38019912