Skip to main content

TB204 △metB
(Bacterial strain #229549)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 229549 Bacteria in agar stab 1 $89

Backbone

  • Vector backbone
    n/a
  • Vector type
    This is a strain, not a plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    37°C
  • Growth Strain(s)
    TB204 △metB
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MG1655 attP21::PR-sfGFP::frt metB:frt
  • Species
    n/a

Cloning Information

  • Cloning method Unknown

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primers for sequence verification of metB knock-out:
Fwd - prEP213, acgatcggtctggcttagtt
Rev - prEP214, tgaccgtaaacccgcatagt

Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TB204 △metB was a gift from Yolanda Schaerli (Addgene plasmid # 229549)
  • For your References section:

    Uptake and leakage rates differentially shape community arrangement and composition of microbial consortia. Pignon E, Hollo G, Steiner T, van Vliet S, Schaerli Y. ISME J. 2025 Jun 13:wraf122. doi: 10.1093/ismejo/wraf122. 10.1093/ismejo/wraf122 PubMed 40509754