TB205 △proC △hisL
(Bacterial strain
#229552)
-
PurposeFluorescently labelled (mCherry) E. coli, auxotrophic for proline, histidine overproducer
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Bacterial Strain | 229552 | Bacteria in agar stab | 1 | $89 | |
Backbone
-
Vector backbonen/a
-
Vector typeThis is a strain, not a plasmid
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)TB205 △proC △hisL
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMG1655 attP21::PR-mCherry::frt proC::frt hisL::frt
-
Speciesn/a
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers for sequence verification of hisL knock-out:
Fwd - prEP229, gtgaggataagaggtggcga
Rev - prEP230, tcctttccccgctcattcat
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TB205 △proC △hisL was a gift from Yolanda Schaerli (Addgene plasmid # 229552) -
For your References section:
Uptake and leakage rates differentially shape community arrangement and composition of microbial consortia. Pignon E, Hollo G, Steiner T, van Vliet S, Schaerli Y. ISME J. 2025 Jun 13:wraf122. doi: 10.1093/ismejo/wraf122. 10.1093/ismejo/wraf122 PubMed 40509754