PB OROV Gc Spike H6
(Plasmid
#229662)
-
PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePB-TSW
-
Vector typeMammalian Expression ; PiggyBac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOROV Gc spike
-
Alt nameGc head plus stalk
-
Alt nameOropouche virus M segment
-
SpeciesSynthetic; Oropouche virus (BeAn 19991)
-
Insert Size (bp)1314
-
Mutationcontains residues 482-894 only
-
GenBank IDAJE24679.1
- Promoter TRE
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AflII (not destroyed)
- 5′ sequencing primer CCATAGAAGACACCGGGACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB OROV Gc Spike H6 was a gift from Stephen Graham (Addgene plasmid # 229662 ; http://n2t.net/addgene:229662 ; RRID:Addgene_229662) -
For your References section:
Protein-based tools for the detection and characterisation of Oropouche virus infection. Merchant MK, de Paula Souza J, Abdelkarim S, Chakraborty S, Nasser Neto TA, Gutierrez Manchay KI, de Melo Jorge DM, do Nascimento VA, Sun Y, Caroe ER, Eyssen LEA, Rudd JS, Ribeiro Piauilino IC, Damasceno Pinto S, Pereira da Silva MH, Rocha do Nascimento F, Naveca FG, Proenca-Modena JL, da Silva LLP, Pinto de Figueiredo RM, Owens RJ, Arruda E, Graham SC. EMBO Mol Med. 2025 Aug 11. doi: 10.1038/s44321-025-00291-7. 10.1038/s44321-025-00291-7 PubMed 40790101