Skip to main content
Addgene

PB OROV Gc Spike H6
(Plasmid #229662)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 229662 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    PB-TSW
  • Vector type
    Mammalian Expression ; PiggyBac
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OROV Gc spike
  • Alt name
    Gc head plus stalk
  • Alt name
    Oropouche virus M segment
  • Species
    Synthetic; Oropouche virus (BeAn 19991)
  • Insert Size (bp)
    1314
  • Mutation
    contains residues 482-894 only
  • GenBank ID
    AJE24679.1
  • Promoter TRE
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AflII (not destroyed)
  • 5′ sequencing primer CCATAGAAGACACCGGGACC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB OROV Gc Spike H6 was a gift from Stephen Graham (Addgene plasmid # 229662 ; http://n2t.net/addgene:229662 ; RRID:Addgene_229662)

  • For your References section:

    Protein-based tools for the detection and characterisation of Oropouche virus infection. Merchant MK, de Paula Souza J, Abdelkarim S, Chakraborty S, Nasser Neto TA, Gutierrez Manchay KI, de Melo Jorge DM, do Nascimento VA, Sun Y, Caroe ER, Eyssen LEA, Rudd JS, Ribeiro Piauilino IC, Damasceno Pinto S, Pereira da Silva MH, Rocha do Nascimento F, Naveca FG, Proenca-Modena JL, da Silva LLP, Pinto de Figueiredo RM, Owens RJ, Arruda E, Graham SC. EMBO Mol Med. 2025 Aug 11. doi: 10.1038/s44321-025-00291-7. 10.1038/s44321-025-00291-7 PubMed 40790101
Related items: