pLL5.0_shRNAHsCavin1_MmCavin1_EGFP
              
              
                (Plasmid
                
                #229689)
              
            
            
            
          - 
            PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLL5.0
- Backbone size w/o insert (bp) 7568
- 
              Vector typeLentiviral
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert 1
- 
                Gene/Insert nameshRNA for hCavin1
- 
                  Alt nameCAVIN, CGL4, FKSG13, PTRF, cavin-1
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)75
- 
                        Entrez GeneCAVIN1 (a.k.a. CAVIN, CGL4, FKSG13, PTRF, cavin-1)
- Promoter LTR viral promoter
- 
    
        Tag
        / Fusion Protein
    - EGFP (C terminal on insert)
 
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
Gene/Insert 2
- 
                Gene/Insert namemCavin1
- 
                  Alt namePtrf; Cavin; Cav-p60; 2310075E07Rik
- 
                    SpeciesM. musculus (mouse)
- 
                  Insert Size (bp)1176
- 
                        Entrez GeneCavin1 (a.k.a. 2310075E07Rik, Cav-p60, Cavin, Ptrf)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
hCAVIN1 shRNA: TCACCTTCCACGTCAAGAAGATCCGCGAGGTTCAAGAGACCTCGCGGATCTTCTTGACGTGGAAGGTGTTTTTTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLL5.0_shRNAHsCavin1_MmCavin1_EGFP was a gift from Alpha Yap (Addgene plasmid # 229689 ; http://n2t.net/addgene:229689 ; RRID:Addgene_229689)
- 
                For your References section: Caveola mechanotransduction reinforces the cortical cytoskeleton to promote epithelial resilience. Brooks JW, Tillu V, Eckert J, Verma S, Collins BM, Parton RG, Yap AS. Mol Biol Cell. 2023 Nov 1;34(12):ar120. doi: 10.1091/mbc.E23-05-0163. Epub 2023 Sep 6. 10.1091/mbc.E23-05-0163 PubMed 37672337
