pcDNA3.1(-)-EGFP-FP4-mito
(Plasmid
#229692)
-
PurposeTransient expression of EGFP FP4-mito in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA 3.1(-)
- Backbone size w/o insert (bp) 5401
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP; Mitochondira FP4 motifs from Listeria ActA
-
SpeciesListeria monocytogenes
-
Insert Size (bp)1875
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer T7 Forward; TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(-)-EGFP-FP4-mito was a gift from Alpha Yap (Addgene plasmid # 229692 ; http://n2t.net/addgene:229692 ; RRID:Addgene_229692) -
For your References section:
Ena/VASP proteins can regulate distinct modes of actin organization at cadherin-adhesive contacts. Scott JA, Shewan AM, den Elzen NR, Loureiro JJ, Gertler FB, Yap AS. Mol Biol Cell. 2006 Mar;17(3):1085-95. doi: 10.1091/mbc.e05-07-0644. Epub 2005 Dec 21. 10.1091/mbc.e05-07-0644 PubMed 16371509