PX459-CTNNA1(α-catenin CRISPR KO)
(Plasmid
#229708)
-
PurposeKnockout of a-catenin in mammalian cells using CRISPR-Cas9 technology
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX459
-
Backbone manufacturerFeng Zhang (Addgene plasmid #62988)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCTNNA1 (alpha-catenin) Human
-
Alt nameMDBS2; MDPT2; CAP102
-
gRNA/shRNA sequenceGAAATGACTGCTGTCCATGC
-
SpeciesH. sapiens (human)
-
Entrez GeneCTNNA1 (a.k.a. CAP102, MDBS2, MDPT2)
- Promoter CMV promoter
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX459-CTNNA1(α-catenin CRISPR KO) was a gift from Alpha Yap (Addgene plasmid # 229708 ; http://n2t.net/addgene:229708 ; RRID:Addgene_229708) -
For your References section:
An E-cadherin-actin clutch translates the mechanical force of cortical flow for cell-cell contact to inhibit epithelial cell locomotion. Noordstra I, Hermoso MD, Schimmel L, Bonfim-Melo A, Currin-Ross D, Duong CN, Kalappurakkal JM, Morris RG, Vestweber D, Mayor S, Gordon E, Roca-Cusachs P, Yap AS. Dev Cell. 2023 Sep 25;58(18):1748-1763.e6. doi: 10.1016/j.devcel.2023.06.011. Epub 2023 Jul 21. 10.1016/j.devcel.2023.06.011 PubMed 37480844