pPB-EF1A-HALO-hLRRK2 (LIR2 mutant WTFI -> ATFA)
(Plasmid
#229743)
-
PurposeExpresses Halo tagged human LRRK2 with LIR2 point mutations in mammalian cells. Stable expression with piggybac transposase.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229743 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPB-EF1A
-
Backbone manufacturerVectorbuilder
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLRRK2
-
SpeciesH. sapiens (human)
-
MutationLIR2 mutant WTFI -> ATFA
-
Entrez GeneLRRK2 (a.k.a. AURA17, DARDARIN, PARK8, RIPK7, ROCO2)
- Promoter EF1A
-
Tag
/ Fusion Protein
- Halo (N terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-EF1A-HALO-hLRRK2 (LIR2 mutant WTFI -> ATFA) was a gift from Shawn Ferguson (Addgene plasmid # 229743 ; http://n2t.net/addgene:229743 ; RRID:Addgene_229743) -
For your References section:
A STING-CASM-GABARAP pathway activates LRRK2 at lysosomes. Bentley-DeSousa A, Roczniak-Ferguson A, Ferguson SM. J Cell Biol. 2025 Feb 3;224(2):e202310150. doi: 10.1083/jcb.202310150. Epub 2025 Jan 15. 10.1083/jcb.202310150 PubMed 39812709