Skip to main content

pPB-EF1A-HALO-hLRRK2 (LIR1+2 mutant WEVL -> AEVA / WTFI -> ATFA)
(Plasmid #229744)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229744 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPB-EF1A
  • Backbone manufacturer
    Vectorbuilder
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LRRK2
  • Species
    H. sapiens (human)
  • Mutation
    LIR1+2 mutant WEVL -> AEVA / WTFI -> ATFA
  • Entrez Gene
    LRRK2 (a.k.a. AURA17, DARDARIN, PARK8, RIPK7, ROCO2)
  • Promoter EF1A
  • Tag / Fusion Protein
    • Halo (N terminal on insert)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB-EF1A-HALO-hLRRK2 (LIR1+2 mutant WEVL -> AEVA / WTFI -> ATFA) was a gift from Shawn Ferguson (Addgene plasmid # 229744 ; http://n2t.net/addgene:229744 ; RRID:Addgene_229744)
  • For your References section:

    A STING-CASM-GABARAP pathway activates LRRK2 at lysosomes. Bentley-DeSousa A, Roczniak-Ferguson A, Ferguson SM. J Cell Biol. 2025 Feb 3;224(2):e202310150. doi: 10.1083/jcb.202310150. Epub 2025 Jan 15. 10.1083/jcb.202310150 PubMed 39812709