pTYB1-MBD2-N pc4789
(Plasmid
#229753)
-
PurposeBacterial expression plasmid of MBD2-N (N-terminus of MBD2: aa 1-152). C-terminal tagged to intein.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229753 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTYB1
-
Backbone manufacturerNEB
- Total vector size (bp) 8155
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMBD2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)456
-
MutationN-terminus of MBD2: aa 1-152
-
Entrez GeneMbd2 (a.k.a. MBD2a)
- Promoter T7
-
Tag
/ Fusion Protein
- Intein (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYB1-MBD2-N pc4789 was a gift from Cristina Cardoso (Addgene plasmid # 229753 ; http://n2t.net/addgene:229753 ; RRID:Addgene_229753)