pTYB1-MBD2-MBDTRD pc4791
(Plasmid
#229754)
-
PurposeBacterial expression vector of MBD2-MBDTRD domains (aa 153-235) C-terminal tagged to the intein.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229754 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTYB1-MeCP2 pc1291
- Total vector size (bp) 8905
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMBD2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)247
-
MutationMBD2-MBDTRD domains (aa 153-235)
-
Entrez GeneMbd2 (a.k.a. MBD2a)
- Promoter T7
-
Tag
/ Fusion Protein
- Intein (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYB1-MBD2-MBDTRD pc4791 was a gift from Cristina Cardoso (Addgene plasmid # 229754 ; http://n2t.net/addgene:229754 ; RRID:Addgene_229754) -
For your References section:
Heterochromatome wide analyses reveal MBD2 as a phase separation scaffold for heterochromatin compartmentalization and composition. Zhang H, Ugur E, Hake C, Romero H, Arroyo M, Mahmoud M, Lermyte F, Leonhardt H, Cardoso MC. Nucleic Acids Res. 2025 Nov 26;53(22):gkaf1380. doi: 10.1093/nar/gkaf1380. 10.1093/nar/gkaf1380 PubMed 41416523