pmMBD2∆C-G pc4794
(Plasmid
#229757)
-
PurposeMammalian expression vector of MBD2. The Protein is lacking the C-terminus: aa 236-414. C-terminal tagged to GFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClonetech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMBD2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)714
-
MutationMBD2 lacking the C-terminus: aa 236-414.
-
Entrez GeneMbd2 (a.k.a. MBD2a)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCAGAGGGGTTGAGATGTGTTAAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmMBD2∆C-G pc4794 was a gift from Cristina Cardoso (Addgene plasmid # 229757 ; http://n2t.net/addgene:229757 ; RRID:Addgene_229757) -
For your References section:
Heterochromatome wide analyses reveal MBD2 as a phase separation scaffold for heterochromatin compartmentalization and composition. Zhang H, Ugur E, Hake C, Romero H, Arroyo M, Mahmoud M, Lermyte F, Leonhardt H, Cardoso MC. Nucleic Acids Res. 2025 Nov 26;53(22):gkaf1380. doi: 10.1093/nar/gkaf1380. 10.1093/nar/gkaf1380 PubMed 41416523