pmMBD2∆C∆GR-G pc5086
(Plasmid
#229762)
-
PurposeMammalian expression plasmid of MBD2-∆C∆GR. N-terminus of MBD2 lacking the glycine/arginine rich domain: aa75-96. C-terminal tagged to GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-MBD2∆C (pc4794)
-
Backbone manufacturerCardoso lab
- Total vector size (bp) 5423
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMBD2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)645
-
MutationMBD2 lacking the C-terminus and glycine/arginine rich domain in N-terminus: aa75-96
-
Entrez GeneMbd2 (a.k.a. MBD2a)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGGGCTGCGGACACGGAG
- 3′ sequencing primer GCAGAGGGGTTGAGATGTGTTAAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmMBD2∆C∆GR-G pc5086 was a gift from Cristina Cardoso (Addgene plasmid # 229762 ; http://n2t.net/addgene:229762 ; RRID:Addgene_229762) -
For your References section:
Heterochromatome wide analyses reveal MBD2 as a phase separation scaffold for heterochromatin compartmentalization and composition. Zhang H, Ugur E, Hake C, Romero H, Arroyo M, Mahmoud M, Lermyte F, Leonhardt H, Cardoso MC. Nucleic Acids Res. 2025 Nov 26;53(22):gkaf1380. doi: 10.1093/nar/gkaf1380. 10.1093/nar/gkaf1380 PubMed 41416523