Skip to main content

pmMBD2∆C∆GR-G pc5086
(Plasmid #229762)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229762 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-MBD2∆C (pc4794)
  • Backbone manufacturer
    Cardoso lab
  • Total vector size (bp) 5423
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MBD2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    645
  • Mutation
    MBD2 lacking the C-terminus and glycine/arginine rich domain in N-terminus: aa75-96
  • Entrez Gene
    Mbd2 (a.k.a. MBD2a)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer CGGGCTGCGGACACGGAG
  • 3′ sequencing primer GCAGAGGGGTTGAGATGTGTTAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmMBD2∆C∆GR-G pc5086 was a gift from Cristina Cardoso (Addgene plasmid # 229762 ; http://n2t.net/addgene:229762 ; RRID:Addgene_229762)
  • For your References section:

    Heterochromatome wide analyses reveal MBD2 as a phase separation scaffold for heterochromatin compartmentalization and composition. Zhang H, Ugur E, Hake C, Romero H, Arroyo M, Mahmoud M, Lermyte F, Leonhardt H, Cardoso MC. Nucleic Acids Res. 2025 Nov 26;53(22):gkaf1380. doi: 10.1093/nar/gkaf1380. 10.1093/nar/gkaf1380 PubMed 41416523