pCG-scr
(Plasmid
#229847)
-
PurposeExpresses wild-type Cas9 and scrambled gRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 229847 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneLentiCRISPRv2
-
Backbone manufacturerAddgene Plasmid #52961
- Backbone size w/o insert (bp) 12993
- Total vector size (bp) 6937
-
Modifications to backboneRemove sequences required for lentiviral packaging and puromycin selection.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameguide RNA with scrambled sequence
-
gRNA/shRNA sequencecctgggttagagctaccgca
-
SpeciesH. sapiens (human)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCG-scr was a gift from Natsuko Chiba (Addgene plasmid # 229847 ; http://n2t.net/addgene:229847 ; RRID:Addgene_229847)