LentiCRISPRv2-ACTB-C4
(Plasmid
#229849)
-
PurposeExpresses wild-type Cas9 and gRNA for ACTB gene. The target sequence is changed from ACTB-C1 to improve the cut efficiency.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 229849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLentiCRISPRv2
-
Backbone manufacturerAddgene Plasmid #52961
- Backbone size w/o insert (bp) 12993
- Total vector size (bp) 13013
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameguide RNA for ACTB gene
-
gRNA/shRNA sequenceAGTCCGCCTAGAAGCATTTG
-
SpeciesH. sapiens (human)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPRv2-ACTB-C4 was a gift from Natsuko Chiba (Addgene plasmid # 229849 ; http://n2t.net/addgene:229849 ; RRID:Addgene_229849)