pcDNA3.1 Flag-TUBG2
(Plasmid
#229855)
-
PurposeTUBG2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 229855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerthermofisher
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6784
-
Modifications to backboneThe flag-tag was inserted in the pcDNA3-TUBG2 (Addgene plasmid 171966) vector using a Quikchange Mutagenesis Kit (Stratagene) with the following oligos: 5’TGGAATTCACCATGGATTACAAGGATGACGACGATAAGATCCCCCGGGA GATCAT3’ and 5’ATGATCTCCCGGGGGATCTTATCGTCGTCATCCTTGTA ATCCATGGTGAATTCCA3’.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTUBG2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1356
-
MutationRemoval of the internal TUBG2-EcoRI site by changing the nucleotide from A to G at position 117.
-
GenBank IDNM_016437.3
-
Entrez GeneTUBG2
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymCherry tagged TUBG2/pReceiver-M56 was purchased from GeneCopeia, Rockville, USA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The internal EcoRI was removed from the GeneCopeia mCherry tagged TUBG2/pReceiver-M56 plasmid and TUBG2 was sub-cloned into pcDNA3.1, and a Flag was added to the N-terminal region of TUBG2.
To create a TUBG2 gene resistant to human pTER gamma-tubulin shRNA (Addgene plasmid #87955) and single guide RNA TUBG2, the following silent mutations have been introduced:
G to A at position 30
C to A at position 33
C to T at position 1236
C to T at position 1242
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1 Flag-TUBG2 was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 229855 ; http://n2t.net/addgene:229855 ; RRID:Addgene_229855) -
For your References section:
Targeting TUBG1 in RB1-negative tumors. Lindstrom L, Zhou J, Villoutreix BO, Malycheva D, Otrocka M, Gustavsson AL, Lundback T, Bliman D, Shameem MA, Straw M, Riesbeck K, Olsson R, Alvarado-Kristensson M. FASEB J. 2025 Mar 15;39(5):e70431. doi: 10.1096/fj.202403180RR. 10.1096/fj.202403180RR PubMed 40019206