Skip to main content

pSpCas9 (BB)-2A-GFP-RB1sg
(Plasmid #229857)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229857 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9 (BB)-2A-GFP
  • Backbone manufacturer
    Dr. Zhang
  • Backbone size w/o insert (bp) 9289
  • Total vector size (bp) 9309
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RB1sgRNA
  • Alt name
    RB1
  • gRNA/shRNA sequence
    CCGAAAAACGGCCGCCACCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    RB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
  • Tag / Fusion Protein
    • The gamma-tubulin sgRNA is coexpressed with 3xFLAG-Cas9-GFP

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9 (BB)-2A-GFP-RB1sg was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 229857 ; http://n2t.net/addgene:229857 ; RRID:Addgene_229857)
  • For your References section:

    Targeting TUBG1 in RB1-negative tumors. Lindstrom L, Zhou J, Villoutreix BO, Malycheva D, Otrocka M, Gustavsson AL, Lundback T, Bliman D, Shameem MA, Straw M, Riesbeck K, Olsson R, Alvarado-Kristensson M. FASEB J. 2025 Mar 15;39(5):e70431. doi: 10.1096/fj.202403180RR. 10.1096/fj.202403180RR PubMed 40019206