pDF1b-iRGP
(Plasmid
#229978)
-
PurposeRhamnose inducible expression of Rhodotorula glutinis RgPAL gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepDF1b
- Backbone size w/o insert (bp) 7861
- Total vector size (bp) 11102
-
Modifications to backboney25f mobA mutation at 5574-5575 Mutated site in mobA gene with inactivated nickase activity to increase transformation efficiency, based on: Bishe B, Taton A, Golden JW. Modification of RSF1010-Based Broad-Host-Range Plasmids for Improved Conjugation and Cyanobacterial Bioprospecting. iScience. 2019;20:216-228.doi:10.1016/j.isci.2019.09.002
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namePrha Rhamnose Inducible Promoter
-
SpeciesSynthetic
-
Insert Size (bp)1099
- Promoter n/a
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ttattgcagaaagccatc
- 3′ sequencing primer ttctacctcctttgtatattataaac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRhodotorula glutinis RgPAL
-
SpeciesRhodotorula glutinis
-
Insert Size (bp)2142
- Promoter Prha
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer atggcacctagcgttgac
- 3′ sequencing primer ctaggccatcatcttgactaatac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Twenty-six initial pDF plasmids were generously shared with us by the lab of Dr. Paulo Kallio. Dr. Jacob Sebesta generated the initial pDF1b backbone used in this study.
The Prha rhamnose inducible promoter was synthesized based on:
Kelly CL, Taylor GM, Hitchcock A, Torres-Méndez A, Heap JT. A Rhamnose-inducible system for precise and temporal control of gene expression in cyanobacteria. ACS Synth Biol. 2018;7(4):1056-1066. doi:10.1021/acssynbio.7b00435
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDF1b-iRGP was a gift from Christie Peebles (Addgene plasmid # 229978 ; http://n2t.net/addgene:229978 ; RRID:Addgene_229978) -
For your References section:
Improving trans-cinnamic acid production in a model cyanobacterium. Hunstiger D, Ma H, Paton AJ, Peebles CAM. Biotechnol Prog. 2025 Mar-Apr;41(2):e3512. doi: 10.1002/btpr.3512. Epub 2024 Oct 1. 10.1002/btpr.3512 PubMed 40235106