fabp10a:lox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR; cryaa:mCherry
(Plasmid
#230043)
-
PurposePartial ablation and subsequent lineage tracing of regenerating hepatocytes in zebrafish.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 230043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonefabp10a:flag-SpiCee-mRFP1; cryaa:mCherry
-
Vector typeCre/Lox ; Zebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR
-
Alt nameBB-NTR
-
SpeciesD. rerio (zebrafish); Aequorea victoria, Entacmaea quadricolor, Discosoma sp., E.coli
-
Insert Size (bp)4634
-
GenBank IDAAV52164 OP373690.1
- Promoter fabp10a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gtcgtcaaatcctggtgcaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.09.629100 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
fabp10a:lox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR; cryaa:mCherry was a gift from Sumeet Pal Singh (Addgene plasmid # 230043 ; http://n2t.net/addgene:230043 ; RRID:Addgene_230043) -
For your References section:
Cholangiocytes contribute to hepatocyte regeneration after partial liver injury during growth spurt in zebrafish. Eski SE, Mi J, Pozo-Morales M, Hovhannisyan GG, Perazzolo C, Manco R, Ez-Zammoury I, Barbhaya D, Lefort A, Libert F, Marini F, Gurzov EN, Andersson O, Singh SP. Nat Commun. 2025 Jun 6;16(1):5260. doi: 10.1038/s41467-025-60334-y. 10.1038/s41467-025-60334-y PubMed 40480975