pCLYBL-Neo_TRE3VG_mCherry_Responder
(Plasmid
#230054)
-
PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of mCherry through the OPTi-OX platform. The CLYBL GSH supports higher transgene expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 230054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHEC015_CLYBL_neo_CAG_dCas9-P2A-T2A-mCherry
- Backbone size w/o insert (bp) 7887
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRE3VG_mCherry
-
SpeciesSynthetic
-
Insert Size (bp)1351
- Promoter TRE3VG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tccaggacggagtcagtgag
- 3′ sequencing primer GAATTCGAGCTCGGTACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCLYBL-Neo_TRE3VG_mCherry_Responder was a gift from Alessandro Bertero (Addgene plasmid # 230054 ; http://n2t.net/addgene:230054 ; RRID:Addgene_230054) -
For your References section:
Overcoming the Silencing of Doxycycline-Inducible Promoters in hiPSC-derived Cardiomyocytes. Guichardaz M, Bottini S, Balmas E, Bertero A. Open Res Eur. 2024 Dec 18;4:266. doi: 10.12688/openreseurope.19024.1. eCollection 2024. 10.12688/openreseurope.19024.1 PubMed 39926351