pMS08
(Plasmid
#230072)
-
Purpose(Empty Backbone) Constitutive expression Promoter (RpoD sigma factor, BT_RS06635), integrates via IntN1; N-/C-terminal mScarlet-I fusion, ermF, C-terminal 3x-FLAG, R6K ori, RP4 oriT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 230072 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMS08
- Backbone size (bp) 6137
-
Vector typeBacterial Expression, Synthetic Biology
- Promoter RpoD (bt_1311/BT_RS06635)
-
Selectable markersErythromycin
-
Tags
/ Fusion Proteins
- 3xFLAG (C terminal on backbone)
- mScarlet-I (N terminal on backbone)
- mScarlet-I (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Growth instructions5 ug/mL erythromycin used for selection in B. fragilis.
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TGTCGTAACTTTGCACTCCAAA
- 3′ sequencing primer TCACTTGTCGTCGTCATCCTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMS08 was a gift from Sean Crosson (Addgene plasmid # 230072 ; http://n2t.net/addgene:230072 ; RRID:Addgene_230072) -
For your References section:
Genetic- and culture-based tools for studying Bacteroides fragilis. Schnizlein MK, Dubey AA, Fiebig A, Crosson S. Microbiol Resour Announc. 2025 May 8;14(5):e0000625. doi: 10.1128/mra.00006-25. Epub 2025 Mar 25. 10.1128/mra.00006-25 PubMed 40130927