Skip to main content
Addgene

pMS08
(Plasmid #230072)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 230072 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMS08
  • Backbone size (bp) 6137
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Promoter RpoD (bt_1311/BT_RS06635)
  • Selectable markers
    Erythromycin
  • Tags / Fusion Proteins
    • 3xFLAG (C terminal on backbone)
    • mScarlet-I (N terminal on backbone)
    • mScarlet-I (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Growth instructions
    5 ug/mL erythromycin used for selection in B. fragilis.
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TGTCGTAACTTTGCACTCCAAA
  • 3′ sequencing primer TCACTTGTCGTCGTCATCCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMS08 was a gift from Sean Crosson (Addgene plasmid # 230072 ; http://n2t.net/addgene:230072 ; RRID:Addgene_230072)
  • For your References section:

    Genetic- and culture-based tools for studying Bacteroides fragilis. Schnizlein MK, Dubey AA, Fiebig A, Crosson S. Microbiol Resour Announc. 2025 May 8;14(5):e0000625. doi: 10.1128/mra.00006-25. Epub 2025 Mar 25. 10.1128/mra.00006-25 PubMed 40130927