pLentiCRISPR v2-sgL2HGDH-3
(Plasmid
#230085)
-
PurposeCrispr knock out human L2HGDH gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 230085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2-Blast
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 14684
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL2HGDH
-
gRNA/shRNA sequenceCACCAGACTGGACATAACAG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneL2HGDH (a.k.a. DURANIN, FLJ12618, C14orf160)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer common
- 3′ sequencing primer common (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPR v2-sgL2HGDH-3 was a gift from Xingguo Zhu (Addgene plasmid # 230085 ; http://n2t.net/addgene:230085 ; RRID:Addgene_230085) -
For your References section:
Transsulfuration pathway activation attenuates oxidative stress and ferroptosis in sickle primary erythroblasts and transgenic mice. Xi C, Pang J, Xue W, Cui Y, Jiang N, Zhi W, Shi H, Horuzsko A, Pace BS, Zhu X. Commun Biol. 2025 Jan 6;8(1):15. doi: 10.1038/s42003-024-07424-7. 10.1038/s42003-024-07424-7 PubMed 39762627