pWZ414-F51
(Plasmid
#23075)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 23075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS414 delta Afl III- Sma I
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4348
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameyeast Histone H3-2 and Histone H4-2
-
Alt nameHHT2-HHF2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1900
-
MutationHistone H4 changed Lysines 5 and 12 to Glutamine, H4 K5,12Q
-
GenBank IDS000004976 S000004975
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Afl III (not destroyed)
- 3′ cloning site Spe I (unknown if destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer CACCTCTGACTTGAGCGTCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byfrom Dr. Mary Ann Osley, currently at the Univ. of New Mexico, Albuquerque, NM
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWZ414-F51 was a gift from Sharon Dent (Addgene plasmid # 23075 ; http://n2t.net/addgene:23075 ; RRID:Addgene_23075) -
For your References section:
Essential and redundant functions of histone acetylation revealed by mutation of target lysines and loss of the Gcn5p acetyltransferase. Zhang W, Bone JR, Edmondson DG, Turner BM, Roth SY. EMBO J. 1998 Jun 1. 17(11):3155-67. 10.1093/emboj/17.11.3155 PubMed 9606197