Skip to main content

pWZ414-F25
(Plasmid #23082)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 23082 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS414 delta Afl III- Sma I
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4348
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    yeast Histone H3-2 and Histone H4-2
  • Alt name
    HHT2-HHF2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1900
  • Mutation
    Histone H4 changed lysine 16 to Glutamine, H4 K16Q.
  • GenBank ID
    S000004976 S000004975

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Afl III (not destroyed)
  • 3′ cloning site Spe I (unknown if destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer CACCTCTGACTTGAGCGTCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    from Dr. Mary Ann Osley, currently at the Univ. of New Mexico, Albuquerque, NM

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWZ414-F25 was a gift from Sharon Dent (Addgene plasmid # 23082 ; http://n2t.net/addgene:23082 ; RRID:Addgene_23082)
  • For your References section:

    Different sensitivities of bromodomain factors 1 and 2 to histone H4 acetylation. Matangkasombut O, Buratowski S. Mol Cell. 2003 Feb . 11(2):353-63. 10.1016/S1097-2765(03)00033-9 PubMed 12620224