pJD112
(Plasmid
#23088)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 23088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS414 delta Afl III- Sma I
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4348
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameyeast Histone H3-2 and Histone H4-2
-
Alt nameHHT2-HHF2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1900
-
MutationHistone 3 Changed Serine 10 to Aspartate, H3 S10D.
-
GenBank IDS000004976 S000004975
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Afl III (not destroyed)
- 3′ cloning site Spe I (unknown if destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer CACCTCTGACTTGAGCGTCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byfrom Dr. Mary Ann Osley, currently at the Univ. of New Mexico, Albuquerque, NM
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJD112 was a gift from Sharon Dent (Addgene plasmid # 23088 ; http://n2t.net/addgene:23088 ; RRID:Addgene_23088) -
For your References section:
Site-specific loss of acetylation upon phosphorylation of histone H3. Edmondson DG, Davie JK, Zhou J, Mirnikjoo B, Tatchell K, Dent SY. J Biol Chem. 2002 Aug 16. 277(33):29496-502. 10.1074/jbc.M200651200 PubMed 12039950