act5C-mScarlet
(Plasmid
#230906)
-
PurposeUbiquitous expression of mScarlet in Drosophila melanogaster
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAct5C
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemScarlet
- Promoter act5C
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGCACCGGCATTCGTTAAGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.11.26.625385 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
act5C-mScarlet was a gift from Michael Boutros (Addgene plasmid # 230906 ; http://n2t.net/addgene:230906 ; RRID:Addgene_230906) -
For your References section:
Improved in vivo gene knockout with high specificity using multiplexed Cas12a sgRNAs. Port F, Buhmann MA, Zhou J, Stricker M, Vaughan-Brown A, Michalsen AC, Rossmanith E, Poltl A, Grosskurth L, Huber J, Menendez Kury LB, Weberbauer B, Hubl M, Puscher E, Heigwer F, Boutros M. Nat Commun. 2026 Jan 15;17(1):877. doi: 10.1038/s41467-026-68434-z. 10.1038/s41467-026-68434-z PubMed 41540063