GMR11F02-Gal4 UAS-GFP
(Plasmid
#230907)
-
PurposeTissue-specific expression of GFP in wing and haltere imaginal discs.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGMR11F02-Gal4
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
- Promoter GMR11F02Gal4-UAS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAACTAGGCTAGAGCTTAGGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.11.26.625385 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GMR11F02-Gal4 UAS-GFP was a gift from Michael Boutros (Addgene plasmid # 230907 ; http://n2t.net/addgene:230907 ; RRID:Addgene_230907) -
For your References section:
Improved in vivo gene knockout with high specificity using multiplexed Cas12a sgRNAs. Port F, Buhmann MA, Zhou J, Stricker M, Vaughan-Brown A, Michalsen AC, Rossmanith E, Poltl A, Grosskurth L, Huber J, Menendez Kury LB, Weberbauer B, Hubl M, Puscher E, Heigwer F, Boutros M. Nat Commun. 2026 Jan 15;17(1):877. doi: 10.1038/s41467-026-68434-z. 10.1038/s41467-026-68434-z PubMed 41540063